Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Recombinant Human TIGIT.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq?-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
Each lot of this antibody is quality control tested by?immunofluorescent staining with flow cytometric analysis?and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with?Mission Bio’s Tapestri Single-Cell Sequencing Platform?for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq? products. For example, for any technology platform Buyer uses with TotalSeq?, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq? with that platform.- Application Notes
This clone can suppress anti-CD3 induced T cell proliferation in vitro based on in-house testing.
This clone has been tested in-house and determined to not be suitable for applications in immunohistochemistry of paraffin-embedded tissue sections (IHC-P).
Additional reported applications (for the relevant formats) include: Blocking1.- Additional Product Notes
TotalSeq?-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes.- Application References
(PubMed link indicates BioLegend citation) -
- Stamm H, et al. 2018. Oncogene. Pubmed
- RRID
- AB_2892456 (BioLegend Cat. No. 372739)
Antigen Details
- Structure
- 26kD; type I transmembrane protein, Ig-like V-type domain, ITIM motif.
- Distribution
-
Activated T cells, Regulatory T cells (Treg), Follicular Helper T cells (TFH), NK cells.
- Function
- Cell signaling, negative regulation of T cells, T cell tolerance, T cell anergy.
- Ligand/Receptor
- CD155 (PVR), CD112 (PVRL2, NECTIN-2).
- Cell Type
- NK cells, T cells, Tfh, Tregs
- Biology Area
- Cell Adhesion, Cell Biology, Immunology, Inhibitory Molecules, Signal Transduction
- Molecular Family
- Adhesion Molecules, Immune Checkpoint Receptors
- Antigen References
-
1. Stanietsky N, et al. 2009. Proc. Natl. Acad. Sci. 106:17858.
2. Yu X, et al. 2009. Nat. Immunol. 10:48.
3. Johnston R, et al. 2014. Cancer Cell. 26:923. - Gene ID
- 201633 View all products for this Gene ID
- UniProt
- View information about TIGIT on UniProt.org