Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Recombinant human CD279 protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and 1 mM EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq?-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
Each lot of this antibody is quality control tested by?immunofluorescent staining with flow cytometric analysis?and the oligomer sequence is confirmed by sequencing. TotalSeq?-D antibodies are compatible with?Mission Bio’s Tapestri Single-Cell Sequencing Platform?for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension.?For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 ?g per million cells in 100 ?L volume.?Refer to the corresponding TotalSeq? protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq? products. For example, for any technology platform Buyer uses with TotalSeq?, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq? with that platform.- Application Notes
A17188B antibody can block the binding of NAT105 and EH12.2H7 antibodies to the target.
- Additional Product Notes
TotalSeq?-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes.- RRID
- AB_2892479 (BioLegend Cat. No. 621617)
Antigen Details
- Structure
- 55 kD type I transmembrane protein
- Distribution
-
Transiently expressed on CD4- and CD8- thymocytes, upregulated in thymocytes and splenic T and B lymphocytes, and is expressed on activated myeloid cells.
- Function
- Signaling and co-stimulation (co-inhibition)
- Interaction
- SHP-1 and SHP-2
- Ligand/Receptor
- PD-L1 (CD274) and PD-L2 (CD273)
- Cell Type
- Lymphocytes, T cells
- Biology Area
- Cell Biology, Immuno-Oncology, Inhibitory Molecules
- Molecular Family
- CD Molecules
- Antigen References
-
- Ishida Y, et al. 1992. EMBO J. 11:3887
- Francisco LM, et al. 2010. Immunol Rev. 236:219
- Gene ID
- 5133 View all products for this Gene ID
- UniProt
- View information about CD279 on UniProt.org
